RegulonDB RegulonDB 10.9: Gene Sequence
nimR gene sequence


Size: 822        A: 219  T: 193  G: 216  C: 194

Fasta

 

>nimR E. coli K12. Version NC_000913.3 GI:556503834
atgatgcacaggttgaatctcaatggctatgaacccgaccgacaccatgaagccgcggtc
gcattttgtattcacgccggaacggatgagttaaccagtcctgtacatcagcaccgcaaa
ggacagctgatactggcgctacatggtgcaattacctgtacggtggaaaatgctttgtgg
atggtgccgccacaatatgcggtttggataccgggcggggtggaacatagcaatcaagta
acagctaatgctgaactctgttttctgtttatcgaacccagcgcagtgacaatgccgaca
acatgttgcacattgaaaatatcgcccttatgccgggaattaattttaaccctggcaaac
aggacgacgactcagcgtgctgagccaatgacccgcagattaattcaggtcctgtttgat
gaactccctcagcagccacaacaacagctgcacctgcccgtttcttctcatcctaaaatc
cgcacgatggtggagatgatggcgaaagggcctgtcgagtggggggcattggggcaatgg
gctggcttttttgcgatgagtgaacgcaatcttgcccgactgatagtaaaagagacgggg
ttgagttttcgccagtggcgtcagcagttacagctgattatggcgcttcagggattagtg
aaaggcgatactgtacagaaagttgctcatacgctggggtatgattcaacaacggccttt
attactatgtttaagaaaggcctggggcaaacgccaggccgatatattgcgagattaact
actgtttccccacaatcagcgaaaccagacccgcggcaataa
              
                            

Download fasta file
RegulonDB