RegulonDB RegulonDB 10.9: Gene Sequence
nimT gene sequence


Size: 1182        A: 218  T: 341  G: 315  C: 308

Fasta

 

>nimT E. coli K12. Version NC_000913.3 GI:556503834
atgacctgttcaacttcattaagcggcaaaaacaggattgtccttatcgctggcattctg
atgattgccacaacattacgcgtcacctttaccggcgcagcaccgttactggatacgatt
cgttccgcttactcgctgacgacagcgcaaaccggcttattgaccaccctgccattattg
gcctttgcgctaatctcacctttggctgccccggtagcgcgacgttttggtatggaacgt
agcctgtttgccgcgttacttttgatctgtgctggtatcgcaattcgctctctcccttcg
ccttacttattatttggcggtacagcggtcattggcggtgggattgcattaggcaatgtc
ttactgccaggattaattaaacgcgatttccctcattccgtcgccagacttaccggcgca
tattccctgacaatgggagctgcagcggcactgggatcggctatggtcgtgccgctggct
ttgaacggttttggctggcaaggcgcgttgctcatgctgatgtgttttcctctgctggct
ctttttttatggctgccacagtggcgaagtcaacaacatgcaaatttgagtacctcgcgc
gccttacatactcggggtatctggcgttcaccgcttgcctggcaggtcacattgtttctt
gggatcaactcactggtctattacgtgattattggctggcttccggcgatcctcatcagt
cacggctatagcgaagcacaggcgggttcactgcatggtttgctgcaactagccacagca
gcacccggtttgctgatcccacttttcttacatcatgtgaaagatcagcgtggtattgca
gcgttcgttgccttgatgtgcgcagtgggcgcggttgggctctgctttatgccagcgcac
gcgatcacctggactctgcttttcggttttggttccggcgcaacaatgatactggggttg
acgttcattggtctgcgggctagttctgcgcatcaggcggcggcactctcggggatggca
caatccgtcgggtatttgttggcagcctgtgggccgccgctgatgggtaaaatacacgat
gctaacggtaactggtctgtaccacttatgggtgttgccatactttcactactgatggcg
attttcggactttgcgccgggagagacaaagaaattcgctaa
              
                            

Download fasta file
RegulonDB