RegulonDB RegulonDB 10.9: Gene Sequence
yeaO gene sequence


Size: 348        A: 99  T: 66  G: 90  C: 93

Fasta

 

>yeaO E. coli K12. Version NC_000913.3 GI:556503834
atgaatattcagtgcaaacgcgtttatgatccggctgaacagagcgatggttatcgcata
ctggtcgaccgcctctggccgcgcggtatcaaaaaaaccgatttagcccttgatgagtgg
gataaagaaatcacgccgtcaacggaactgcgcaaagcctttcacggcgaagtcgtcgat
tatgcaacctttcgcgagcaatatcttgcagaactggcgcaacacgagcaagaaggaaag
cggctggcggacatcgccaaaaaacagccgctgaccctgctctactcagcaaaaaacacc
acgcagaaccatgcgctggtgctggccgactggctacgtagcttgtga
              
                            

Download fasta file
RegulonDB