RegulonDB RegulonDB 10.9: Gene Sequence
yoaF gene sequence


Size: 255        A: 62  T: 59  G: 73  C: 61

Fasta

 

>yoaF E. coli K12. Version NC_000913.3 GI:556503834
atgaaaattatcagttttgttctgccttgcttgctggtcctggctggttgttcaacccct
tctcagccagaagcacctaaaccgccgcagattggtatggcaaatccggcgtcggtctat
tgccagcagaagggcgggacgctcattccagtgcagacagcgcaaggggtcagcaacaat
tgcaaattaccgggcggtgaaacgattgatgaatgggcattgtggcggcgtgaccatccg
gctggtgaaaaataa
              
                            

Download fasta file
RegulonDB