RegulonDB RegulonDB 10.9: Gene Sequence
dgcP gene sequence


Size: 1026        A: 269  T: 264  G: 249  C: 244

Fasta

 

>dgcP E. coli K12. Version NC_000913.3 GI:556503834
gtgtcagatcagattatcgcccgcgtctcgcaatcccttgccaaagaacagtcactggaa
agtctggtccgacagcttctggagatgctggaaatggtcactgatatggaatcaacctac
ctgaccaaagtggatgtcgaagcgcgcctgcagcatattatgtttgcccgtaacagccag
aaaatgtacatcccggagaattttaccgtctcgtgggattactcgttatgcaaacgcgcc
attgatgaaaactgctttttcagcgatgaagtccccgaccgttggggtgactgtattgcg
gcacgcaatcttggcatcaccacatttctgagcacgccaattcacttaccggatggatca
ttctatggcacgctttgcgccgccagcagtgagaagcgccagtggagtgaacgcgcggaa
caggttttacagttattcgccggactgattgcacaatatattcaaaaagaggcactggtt
gaacagctgcgcgaagccaatgctgcgctgattgcgcaatcgtataccgactcgttaacc
gggctaccgaatcggcgggcgatttttgaaaatctgacgacactgttttccctcgcccgg
catcttaaccataagataatgatcgcgtttatcgatctggataacttcaaattaatcaat
gatcgttttggtcataatagtggcgatctgtttctcattcaggttggcgagcgccttaat
acgctccagcaaaatggcgaagttattggtcgtctcggcggtgatgagtttttagttgtt
tcactaaacaacgagaatgcggatatttcgtcgctgcgagaacgcattcagcagcaaata
cgtggagaatatcacttaggtgatgttgatttgtattatcccggtgccagtcttggcata
gtagaagtcgatcctgaaacaaccgatgcagacagtgccctgcatgctgccgatattgcg
atgtatcaggagaaaaaacacaaacagaaaacaccttttgtcgcgcatccagcgctacat
tcctga
              
                            

Download fasta file
RegulonDB