RegulonDB RegulonDB 10.9: Gene Sequence
yeaQ gene sequence


Size: 249        A: 50  T: 84  G: 76  C: 39

Fasta

 

>yeaQ E. coli K12. Version NC_000913.3 GI:556503834
atgggcattctgtcatggattatttttgggcttattgccggtattctggcgaagtggatc
atgccaggtaaagatggaggtggattctttatgactatcctgctggggatagtcggtgcc
gtagtcggcggatggatcagcacgctgtttggctttggtaaagtcgatggcttcaatttt
ggcagcttcgtggttgccgttattggtgcgattgtcgtgctatttatctacaggaagatt
aaaagttaa
              
                            

Download fasta file
RegulonDB