RegulonDB RegulonDB 10.10: Gene Sequence
yoaG gene sequence


Size: 183        A: 55  T: 44  G: 50  C: 34

Fasta

 

>yoaG E. coli K12. Version NC_000913.3 GI:556503834
atgggcaaagcaacgtataccgtgaccgtcaccaataacagcaatggcgtttctgtcgat
tatgaaacagagacgccgatgactttgctggtgccagaagtggcggctgaagtgataaaa
gatctggtgaataccgtacgttcttatgacacggaaaacgaacatgatgtttgtggttgg
taa
              
                            

Download fasta file
RegulonDB