RegulonDB RegulonDB 10.9: Gene Sequence
leuE gene sequence


Size: 639        A: 142  T: 208  G: 161  C: 128

Fasta

 

>leuE E. coli K12. Version NC_000913.3 GI:556503834
gtgttcgctgaatacggggttctgaattactggacctatctggttggggccatttttatt
gtgttggtgccagggccaaataccctgtttgtactcaaaaatagcgtcagtagcggtatg
aaaggcggttatcttgcggcctgcggtgtatttattggcgatgcggtattgatgtttctg
gcatgggctggagtggcgacattaattaagaccaccccgatattattcaacattgtacgt
tatcttggtgcgttttatttgctctatctggggagtaaaattctttacgcgaccctgaag
ggtaaaaatagcgaggccaaatccgatgagccccaatacggtgctatttttaaacgcgcg
ttaattttgagcctgactaatccgaaagccattttgttctatgtgtcgtttttcgtacag
tttatcgatgttaatgccccacatacgggaatttcattctttattctggcggcgacgctg
gaactggtgagtttctgctatttgagcttcctgattatatctggtgcttttgtcacgcag
tacatacgtaccaaaaagaaactggctaaagttggcaactcactgattggtttgatgttc
gtgggtttcgctgcccgactggcgacgctgcaatcctga
              
                            

Download fasta file
RegulonDB