RegulonDB RegulonDB 10.9: Gene Sequence
dmlR gene sequence


Size: 924        A: 200  T: 240  G: 264  C: 220

Fasta

 

>dmlR E. coli K12. Version NC_000913.3 GI:556503834
atgaataatttaccgctgctgaatgatttgcgcgtctttatgctggtggctcgccgggct
ggttttgccgccgtggcggaagaactgggcgtttcaccggcgttcgtcagcaagcgcatc
gccttgctggagcaaacgctaaacgtggtgttgttacaccgcaccacccgccgcgtcacc
attaccgaagaaggagagcggatttatgaatgggcgcagcggattttgcaggatgtcggt
cagatgatggacgaactttctgacgtgcgtcaggtgccgcaggggatgctgcgtattatc
agcagctttggttttggacgacaggtggtggctccggcgttattagcgctggcgaaggcg
tatccgcaactggaattacgttttgatgtggaagaccgactggtcgatttggtcaatgaa
ggtgtcgatctcgatattcgcattggcgatgacatcgcccctaatttaatcgcccgcaaa
ctggcgaccaattaccgtattctctgcgcgtcgccggaatttattgcgcaacatggcgcg
ccgaaacatttaaccgatctttctgcattgccgtgcctggtcattaaagagcgcgatcat
ccttttggtgtctggcaattacgcaataaagaaggcccccatgcgattaaagtcaccggc
ccactgtcgtctaatcatggagaaattgtccatcagtggtgtctcgatgggcaggggatt
gctctgcgttcctggtgggatgttagcgaaaacattgccagtggtcatttagtgcaagtg
ctaccggaatattaccagccagcgaacgtctgggccgtttatgtttcaaggctggcgacg
tcagcgaaagtgcggataacggtagaatttttacgccagtattttgccgagcactacccg
aatttttcactggagcatgcctga
              
                            

Download fasta file
RegulonDB