RegulonDB RegulonDB 10.9: Gene Sequence
dmlA gene sequence


Size: 1086        A: 239  T: 264  G: 303  C: 280

Fasta

 

>dmlA E. coli K12. Version NC_000913.3 GI:556503834
atgatgaaaacgatgcgtattgctgcgatcccgggagacgggattggcaaagaagtcctt
cctgaagggattcgcgtgttacaggctgccgctgagcgctggggcttcgccttgagtttt
gagcaaatggagtgggcgagctgcgagtattacagccatcacggtaaaatgatgccggac
gactggcatgagcaacttagccgtttcgacgccatctattttggtgccgtcggctggccg
gataccgttccggaccatatttcgttgtggggttcgctgctgaaatttcgtcgtgaattc
gaccagtacgtcaacctgcgcccggttcgtctctttcctggcgttccctgcccgctggcg
ggaaaacagcctggcgacatcgatttttacgtggtcagggaaaacaccgaaggcgaatat
tcctcgctcggcggtagagtgaatgaaggtacagagcatgaagtcgtcattcaggaatcg
gtatttacccgccgtggtgtcgatcgcattttgcgttatgccttcgaacttgcgcaaagc
cgtccacgtaagacactaacttctgccactaaatcgaacggtttagccatcagcatgccg
tactgggatgagcgagtggaagcaatggccgagaattacccggagatccgctgggacaag
cagcatattgatattctctgcgcgcgttttgtgatgcagccggaacgattcgatgtggtg
gtggcgtccaatttgtttggcgatatcctttccgatcttggcccggcctgcaccggcacc
attggcattgccccatccgccaacctgaatccggaacgcactttcccgtcgctcttcgag
cctgtccacggttccgcgccggatatctacgggaaaaatattgctaaccctatcgccacg
atttgggccggggcaatgatgctcgattttctcggcaatggcgatgagcgtttccagcaa
gcgcataacggtattctggcagcaattgaagaagtgattgctcacgggccgaaaacacct
gatatgaaaggcaatgccaccacgccacaggttgccgacgcgatttgcaaaattattttg
cgttaa
              
                            

Download fasta file
RegulonDB