RegulonDB RegulonDB 10.9: Gene Sequence
yeaV gene sequence


Size: 1446        A: 301  T: 404  G: 356  C: 385

Fasta

 

>yeaV E. coli K12. Version NC_000913.3 GI:556503834
ttggttttgctggcaatgggactggtgatttatttagccaccagtaaatacggcaatatt
cgtcttggcgaaggaaaaccggaatacagcacgctctcctggctgtttatgtttatttgt
gccggtttaggttcttctacgctttattggggggttgctgaatgggcctattattatcaa
acacctggattaaatatcgcaccgcgttcacaacaggcactcgaatttagcgttccctac
tctttcttccactggggcatcagcgcctgggcaacttatacgctggcctcattaatcatg
gcttatcactttcatgtgcggaaaaacaaaggtctgagcctttccggcattattgctgct
attaccggcgttcgcccgcaaggcccatggggaaaactggtcgatttgatgttcctgatc
gccactgtcggcgcactgaccatttcccttgttgttaccgcagcaacctttacccgtggg
ctttccgcgctgaccggtttacccgataacttcaccgtgcaggcatttgtgatcctgctt
tccggcggcattttttgcctaagctcgtggattggtatcaacaacggtttgcaacgtctg
agcaaaatggttggctggggcgcgttcctgctgccattactggtgctgattgtcggccca
accgaatttattaccaacagcatcatcaatgccatcggcctgaccacgcaaaacttcctg
caaatgagcttattcaccgatccgcttggcgatggttcatttacccgcaactggaccgtt
ttctactggctgtggtggatctcatacacccctggcgtagcaatgtttgtcacccgcgtt
tcccgcggtcgtaagattaaagaagttatctggggactgatcctcggcagcaccgtcggt
tgctggttcttctttggcgtaatggaaagctatgccattcatcagtttatcaatggcgta
atcaacgtcccacaggtgctggaaacactgggcggcgaaacagctgtacagcaagttctg
atgtcgttgccagccggtaaattgttcctcgccgcatacctgggcgtgatgattattttc
cttgcctcgcatatggatgcagtggcctacaccatggcggcgaccagtacgcgtaatctc
caggaaggtgacgatcctgaccgtgggctgcgtcttttctggtgcgtggtgatcactctg
atcccgctttccatcttgtttaccggtgcttcgctggaaacgatgaaaaccaccgtcgtg
ctcacagcccttcccttcctcgtcattttactggtgaaagtcggcgggtttattcgctgg
ctgaaacaggattacgccgacattccggctcatcaagttgaacattatctcccgcagaca
ccggttgaagccctggaaaaaacgccagtgctccctgcgggaaccgtattcaaaggcgac
aactga
              
                            

Download fasta file
RegulonDB