RegulonDB RegulonDB 10.9: Gene Sequence
yeaW gene sequence


Size: 1125        A: 283  T: 260  G: 297  C: 285

Fasta

 

>yeaW E. coli K12. Version NC_000913.3 GI:556503834
atgagcaatctgagccctgactttgtactacccgaaaatttttgcgctaacccgcaagag
gcgtggaccattcctgcccgtttttataccgatcagaacgcgtttgaacacgaaaaagag
aacgtcttcgccaaaagctggatttgcgtcgctcacagcagcgaactggcgaatgccaat
gattatgtgacgcgtgagatcattggcgaaagcatcgtgctggtacgcggtcgtgataag
gttttgcgcgcgttctataacgtgtgtccgcaccgtggtcatcagttgttgagcggtgaa
ggaaaagcaaaaaatgtgattacctgcccgtatcacgcatgggcattcaaactcgatggc
aacctggcccatgcacgtaactgcgaaaacgtcgccaatttcgatagcgacaaagcgcaa
ctggttccggtgcgtctggaagaatatgccggattcgtcttcatcaacatggaccccaac
gccaccagcgtagaagatcaattacccggcctgggcgcgaaagtgctggaagcctgcccg
gaagtccacgatctgaaactggcggcccgctttaccacccgcacgcctgccaactggaag
aacattgtcgataactatctcgagtgctatcactgtggtccggcgcatccaggtttctcc
gactccgtacaggttgatcgttactggcacaccatgcacggtaactggacgctgcaatac
ggtttcgccaaaccgtccgaacagtcgtttaaatttgaagagggtacggatgcggcattc
cacggtttctggctgtggccgtgcacgatgctgaacgtcaccccgatcaaagggatgatg
acggtcatttatgaattcccggtggattctgaaactaccctgcaaaactacgatatttac
ttcaccaatgaagagttaaccgacgagcaaaaatcgctgattgagtggtatcgcgatgtg
ttccgtccggaagatttacgtctggttgaaagcgtacagaaagggctgaaatcgcgtggc
tatcgtggtcaggggcgcatcatggccgacagtagcggtagtggcatttccgaacatggt
atcgcccatttccataatctgctggcgcaggtgtttaaggactaa
              
                            

Download fasta file
RegulonDB