RegulonDB RegulonDB 10.8: Gene Sequence
yoaB gene sequence


Size: 345        A: 91  T: 76  G: 95  C: 83

Fasta

 

>yoaB E. coli K12. Version NC_000913.3 GI:556503834
atgactatcgttcgtatcgatgctgaagcccgctggtctgatgtagtaatccacaacaac
acgctctactacactggtgtaccggaaaacctcgacgccgatgcctttgagcaaaccgcc
aacacgctggcacagattgacgccgtgctggaaaaacagggcagcaataaatcgagcatt
ctggatgccaccattttcctggccgataaaaacgacttcgcggcgatgaataaagcgtgg
gatgcttgggttgtcgcgggtcatgcgccggtgcgctgcacggtacaagcgggtttgatg
aacccgaagtataaagttgaaattaagattgtggctgcggtgtaa
              
                            

Download fasta file
RegulonDB