RegulonDB RegulonDB 10.9: Gene Sequence
yoaC gene sequence


Size: 300        A: 99  T: 67  G: 79  C: 55

Fasta

 

>yoaC E. coli K12. Version NC_000913.3 GI:556503834
atgcctgctgtaatagataaagccctggatttcattggtgccatggatgtatcagcgcca
acaccaagttcgatgaatgaaagcacggcgaagggaatctttaaatatttaaaagaactg
ggagtacccgcgagtgccgctgatattacggcgcgagctgaccaggaaggctggaaccct
gggttcacggaaaaaatggttggatgggcaaaaaaaatggagacaggtgaacgttctgtg
attaaaaatcctgaatacttttcaacatatatgcaggaagaactaaaagcactggtctga
              
                            

Download fasta file
RegulonDB