RegulonDB RegulonDB 10.9: Gene Sequence
pdeD gene sequence


Size: 1599        A: 377  T: 414  G: 397  C: 411

Fasta

 

>pdeD E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaaagcacaacggatcattaaaacctatcgtcgtaatcgaatgattgtttgtacg
atttgcgcactcgttacgctcgcttcgaccctgagcgtgcgatttatttcacagcgtaac
ttaaatcaacaacgggtagtacaattcgccaatcacgctgtagaggaattagataaagta
ctgcttcccctacaggcaggtagcgaagtcttgcttccgctgattggtctgccctgctct
gtcgcccatttgccattacgtaaacaggcggcaaaactccaaactgtgcgatccattggc
ctggtgcaagacggcacactttattgctccagcatttttggttatcgcaatgtgcccgtc
gtggacattctggctgaacttcctgcaccgcaaccacttttacgcctgacgatcgaccgt
gccctgattaaaggcagtccggttttgattcaatggacgcctgcagcgggcagtagcaat
gctggggtcatggagatgattaacatcgacttactgacggcaatgctgcttgagccacaa
ctgccgcaaatcagtagcgccagcctgacggtggacaaacggcatttgctctatggtaat
gggctggtagattcccttccgcaacctgaagacaatgaaaactatcaggtttcttcgcaa
cgctttccttttaccattaacgttaatggtccgggggctacggcgctggcatggcactat
cttccaacacaattaccgctggcggtgctgctaagtttactggtgggctacatcgcctgg
ctggcgaccgcttaccgaatgagcttttcccgcgaaatcaatctgggcctggcgcaacat
gagttcgaattgttctgtcagcctttgcttaatgcgcgcagccagcaatgtattggtgta
gagattttgctgcgctggaacaatccgcgtcagggctggatttcaccggatgtgtttatt
cctatcgcggaagaacatcatttaattgtgccactgacccgctatgtgatggcagaaacc
attcgtcagcgccatgttttcccgatgagtagtcagtttcatgttggcattaacgtcgca
cccagccattttcgccgtggtgtgctgataaaagatctcaatcagtactggtttagcgct
cacccgattcagcaactgatcctcgaaatcaccgaacgcgatgccttactggatgttgat
tatcggattgcccgcgagctgcatcgtaaaaacgtcaaactggcgattgatgacttcggc
accggcaacagctcgttttcctggcttgaaacattacgtcctgacgtgctgaaaattgat
aagtcatttaccgcagctataggttctgacgcggttaactcgacggtgaccgatatcatc
atcgcgctggggcaaagactgaatattgaactggtggcggagggcgtggaaacgcaagaa
caggcgaagtatttgcgccgtcatggcgtgcatattttgcaagggtatttgtacgcacag
ccgatgccgctacgtgattttcccaaatggctggcgggcagccaaccgccgcccgcccgg
cataatggacatatcacgcccattatgccgttacgttaa
              
                            

Download fasta file
RegulonDB