RegulonDB RegulonDB 10.9: Gene Sequence
yoaE gene sequence


Size: 1557        A: 315  T: 403  G: 457  C: 382

Fasta

 

>yoaE E. coli K12. Version NC_000913.3 GI:556503834
atggaattcttaatggacccctcaatttgggcggggctactcacgcttgttgttctcgaa
attgtgctgggtatcgataacctggtcttcatcgccattcttgctgacaaactgccgcca
aaacaacgcgataaagcgcgtttgctggggttatcactggcgctgattatgcgtctgggg
ctgctgtcgctgatttcatggatggtcacgctgaccaaaccgctatttaccgtcatggat
ttctccttctccggacgcgacctgattatgttgttcggggggatattcttgctgttcaaa
gcaacaaccgaactgcatgaacggctggaaaaccgcgatcatgattccggccacggtaaa
ggctacgccagtttctgggtggtcgtcacacagattgtcatccttgacgccgtcttctcg
ttggatgcggtaattactgcagtagggatggttaaccatctgccggtgatgatggcggcg
gtagtgattgcgatggcggttatgttgctggcatccaaaccgctgacgcgattcgttaac
cagcaccccacggtggtggtgctctgtctgagcttcctgttaatgattggtctgagtctg
gtggcagaaggtttcggtttccacattccgaaaggttacctgtatgccgcgattggcttc
tcgatcatcatcgaagtgtttaaccagattgcgcgtcgcaactttattcgccaccagtcg
actttgccgctgcgagcgcgtactgccgatgccatcctgcgtttgatgggcgggaaacgt
caggccaatgttcagcacgatgccgataacccgatgccgatgccgatcccggaaggtgca
tttgccgaagaagaacgttacatgattaacggcgtactgacgctggcgtcgcgttctctg
cgcgggatcatgacgccgcgcggtgaaataagctgggttgacgctaatctcggggtcgat
gaaatccgcgagcaactgctctcttcaccgcacagtctgttcccggtatgtcgcggtgaa
ctggatgaaatcatcggtattgtacgtgctaaagaactgctggtggcgctggaagagggc
gttgatgtggcggcgattgcttcggcgtctccggcgattatcgtcccggaaaccctcgat
ccgatcaacctgttgggcgtgctgcgtcgtgctcgcgggagctttgttatcgtgaccaac
gagtttggtgtggtacaaggtctggtcacgccgctggatgtgctggaagccattgcgggt
gaattcccggacgctgacgaaacgccggaaatcattactgatggtgacggctggctggta
aaaggcggtacagatttgcatgccttgcagcaggcgcttgatgttgagcaccttgccgat
gacgatgatatcgcgacggtcgcgggcctcgtgatctcggcaaatggtcacattccccgt
gtgggcgatgtgattgatgtagggccactgcatatcaccatcattgaagccaatgattat
cgtgttgatctggttcgcattgttaaagagcaaccggcgcacgatgaagatgagtaa
              
                            

Download fasta file
RegulonDB