RegulonDB RegulonDB 10.9: Gene Sequence
yobD gene sequence


Size: 459        A: 113  T: 139  G: 99  C: 108

Fasta

 

>yobD E. coli K12. Version NC_000913.3 GI:556503834
atgacaatcacggacctggtactgattcttttcatcgccgcactcctggccttcgcgatc
tacgatcagttcatcatgccccgccgtaacggccccaccctgctggcaattcctttgctc
cggcgtggtcgcatcgatagcgttatcttcgtcggattgattgtcattcttatctataac
aacgtcacgaatcatggtgcgttaataacgacatggttattaagcgcactggctctgatg
ggtttttatatattctggatccgcgttccgaagatcatctttaaacaaaaaggttttttc
ttcgccaatgtctggattgaatatagccgaatcaaagcgatgaacttgtcggaagatggc
gtgttggtgatgcaattagaacagcgtcggctgttaatccgcgttcgaaatatcgacgat
ctggaaaaaatttataagcttctcgtttcaactcaataa
              
                            

Download fasta file
RegulonDB