RegulonDB RegulonDB 10.9: Gene Sequence
mntP gene sequence


Size: 567        A: 113  T: 161  G: 161  C: 132

Fasta

 

>mntP E. coli K12. Version NC_000913.3 GI:556503834
atgaatatcactgctactgttcttcttgcgtttggtatgtcgatggatgcatttgctgca
tcaatcggtaaaggtgccaccctccataaaccgaaattttctgaagcattgcgaaccggc
cttatttttggtgccgtcgaaaccctgacgccgctgatcggctggggaatgggcatgtta
gccagccggtttgtccttgaatggaaccactggattgcgtttgtgctgctgatattcctc
ggcgggcgaatgattattgagggttttcgtggcgcagatgatgaagatgaagagccgcgc
cgtcgacacggtttctggctactggtaaccaccgcgattgccaccagcctggatgccatg
gctgtgggtgttggtcttgctttcctgcaggtcaacattatcgcgaccgcattggccatt
ggttgtgcaaccttgattatgtcaacattagggatgatggttggtcgctttatcggctca
attattgggaaaaaagcggaaattctcggcgggctggtgctgatcggcatcggcgtccag
atcctctggacgcacttccacggttaa
              
                            

Download fasta file
RegulonDB