RegulonDB RegulonDB 10.9: Gene Sequence
yobF gene sequence


Size: 144        A: 38  T: 45  G: 33  C: 28

Fasta

 

>yobF E. coli K12. Version NC_000913.3 GI:556503834
atgtgtggcattttcagtaaagaagtcctgagtaaacacgttgacgttgaataccgcttc
tctgccgagccttatattggtgcctcatgcagtaatgtgtcagttttatctatgttatgc
ctgcgggcgaagaaaacaatctaa
              
                            

Download fasta file
RegulonDB