RegulonDB RegulonDB 10.9: Gene Sequence
yebO gene sequence


Size: 288        A: 84  T: 79  G: 74  C: 51

Fasta

 

>yebO E. coli K12. Version NC_000913.3 GI:556503834
atgaacgaagttgtaaattcaggcgtgatgaacattgcgtctttggttgtatcggtggtg
gttcttcttatcgggctcatcttgtggttttttatcaatcgtgccagttcacggactaac
gaacagattgaactgcttgaggcgttgctggatcagcaaaaacgtcaaaatgcactgtta
cgtcgtttgtgcgaagcaaacgaaccagagaaagcagataaaaagaccgttgagagtcaa
aaatcggttgaagacgaagatattattcgtctggtcgccgaacgataa
              
                            

Download fasta file
RegulonDB