RegulonDB RegulonDB 10.9: Gene Sequence
kdgR gene sequence


Size: 792        A: 201  T: 197  G: 216  C: 178

Fasta

 

>kdgR E. coli K12. Version NC_000913.3 GI:556503834
atggctaacgcagatctggataaacagcctgattctgtatcttccgtgctaaaagttttt
ggcattttgcaggcgctgggtgaagagcgcgaaatagggataaccgagctgtcgcagcgc
gtcatgatgtcaaaaagcaccgtttatcgctttttacagaccatgaaaaccttaggttat
gtggcgcaggaaggggagtcggagaaatattccctgaccctgaaattgtttgaactgggc
gctcgcgcgttacaaaacgtcgatttaattcgtagcgcagatatccagatgcgtgagctc
tcccgcctgaccaaagaaactatccacctcggcgcactggacgaagacagtattgtttac
attcacaaaattgactctatgtacaatttgcgcatgtattcacggattgggcgtcgtaat
ccgctgtacagcaccgcgattggtaaggtactgctggcatggcgcgatcgcgatgaagtg
aagcaaattcttgagggcgtggagtataaacgcagtaccgagcggaccatcaccagtaca
gaagcgttattacccgttctggaccaggtgcgcgagcaggggtatggcgaagataatgaa
gagcaggaagaagggctgcgatgcattgcggtaccggtatttgatcgctttggcgtggtc
attgccggtttgagcatctccttcccgacgttgcgtttctctgaagagcgtttacaggaa
tatgtcgcaatgttgcataccgcagcgcgcaaaatttctgcccaaatgggttatcacgac
tatccgttctga
              
                            

Download fasta file
RegulonDB