RegulonDB RegulonDB 10.9: Gene Sequence
yebQ gene sequence


Size: 1374        A: 244  T: 411  G: 351  C: 368

Fasta

 

>yebQ E. coli K12. Version NC_000913.3 GI:556503834
atgccaaaagttcaggccgacggcctgccattgccccagcgatacggtgcgatattaacc
attgtgattggtatttcgatggccgtccttgacggcgcaatcgccaacgtcgccctgcca
acaatcgccacggaccttcatgccacgccagccagttccatctgggtagtgaacgcctat
caaatcgccattgtcatctccctgctctcgttttcgtttctgggcgatatgtttggctat
cgacgtatttataaatgcggtctggtcgtttttctgttgtcttcactgttctgcgccctt
tctgattcgctgcaaatgctcacccttgcgcgtgtcatacaaggtttcggcggtgcagcg
ttgatgagcgttaataccgcacttatccgcctgatctatccacaacgttttctgggtaga
gggatgggcataaactcgtttattgttgccgtctcttctgctgccgggccgacaattgct
gcagcaatcctctccatcgcatcctggaaatggttatttttaatcaacgtaccgttaggt
attatcgccctgcttctggcgatgcgttttctgccacccaatggttctcgcgccagtaaa
ccccgtttcgacctgcccagcgccgtgatgaacgcgttaaccttcggcctgcttatcact
gcgttgagtggtttcgctcaggggcaatcgctgacgttaattgctgcggaactggtggta
atggttgttgttggtattttctttattcgccgccagctttctcttcccgtaccgctgcta
ccggtggatttactgcgtatcccgctgttttcactttctatttgcacatctgtttgctct
ttctgcgcacaaatgctggcaatggtttccctgcccttttacctgcaaaccgtgctcggg
cgtagtgaagtcgaaacaggtttacttctgacaccgtggccgttagcaacgatggtgatg
gctccgctggcaggctatttgattgaacgcgtacatgcaggattgctgggggctttaggg
ttgttcatcatggctgcggggcttttttccctggttctgctgcccgcgtcacctgcggat
atcaatattatctggccgatgatcttatgtggtgctggatttggcttattccagtcaccc
aataaccacaccattattacctccgcgcctcgcgaacgtagcggtggagccagtggcatg
ttaggaacggctcgtctactgggtcagagtagcggcgcggcgctggtggcgctgatgcta
aatcagtttggagataatggtacacacgtctcgctgatggctgcggctattctggcagtg
attgctgcctgtgtcagtggtttacgtatcactcagccacgatccagggcataa
              
                            

Download fasta file
RegulonDB