RegulonDB RegulonDB 10.9: Gene Sequence
msrC gene sequence


Size: 498        A: 122  T: 131  G: 139  C: 106

Fasta

 

>msrC E. coli K12. Version NC_000913.3 GI:556503834
atgaacaaaacagaattttacgcggatttaaatcgcgactttaacgcgctgatggcggga
gaaaccagttttctggcaacgcttgcgaacaccagtgcgttgttatatgagcgtctcact
gacataaactgggcaggtttttatttgcttgaggacgatacactggtactcggaccattt
cagggcaaaattgcctgtgtccggatacccgtcgggcgcggcgtgtgcggcactgcggtt
gcccgcaatcaagtgcagcgtatcgaggatgttcatgtgtttgacgggcatattgcctgt
gatgcggcgagtaattctgaaattgttctgccgctggtggtgaaaaatcagattattggt
gttctcgacatcgatagtaccgtcttcggtcgctttacagacgaggacgagcaaggctta
cgtcagcttgtggcacagcttgaaaaagtgcttgcaacgacggattacaaaaaattcttt
gcgagcgtcgcaggataa
              
                            

Download fasta file
RegulonDB