RegulonDB RegulonDB 10.9: Gene Sequence
letA gene sequence


Size: 1284        A: 269  T: 372  G: 338  C: 305

Fasta

 

>yebS E. coli K12. Version NC_000913.3 GI:556503834
atggctcttaacacaccacaaattacgccgacaaaaaagataacagtgagggcaatcggc
gaggaactgccgcgtggtgattaccaacgttgcccgcaatgtgacatgctgtttagcctg
cccgagataaattctcatcaaagtgcctattgtccgcgctgtcaggcaaaaattcgtgac
gggcgcgactggtcgctaacgcgcctggcggcaatggccttcaccatgctgttgcttatg
ccgtttgcctggggcgaaccgctgttgcatatctggctgttaggcattcgtattgacgcc
aacgttatgcaaggcatctggcaaatgaccaaacagggcgatgcgataacggggtcgatg
gtctttttctgcgttattggtgccccgctcattctggtgacctccatagcttatttatgg
tttggtaaccgactgggaatgaatttacgtccggtactgctgatgcttgagcgacttaaa
gagtgggtaatgctcgatatctacctggtcggcattggcgttgcttctataaaggtacag
gattatgcccatatccaggctggtgtcggcttgttctcttttgtggcgttggtgatttta
acgacggtgacgttgtcacatcttaatgtcgaagaactgtgggagcgattttatccgcag
cgccccgctacgcgtagggacgagaaacttcgtgtctgtcttgggtgccattttaccggc
tatccagatcagcgtggtcgctgcccgcgttgccatatcccgctacgcctgcgtcgccgt
catagtctgcaaaaatgctgggcggcgctgttagcgtcaatcgttttattgttacctgcc
aacctgttgcctatttctatcatttatctgaacggaggacggcaggaagatacaattctt
tccggaattatgtcgctggcaagtagcaacattgcggttgcaggaatcgtgtttatcgcc
agtattctggtaccgtttactaaagtgatcgtcatgttcactttactgttgagcattcat
tttaaatgccagcaaggtttacgcacacgcattctgttactgcggatggtgacctggatt
ggtcgctggtcgatgctcgacctgtttgtcatatctttaaccatgtcgctgattaatcgc
gatcagatcctcgcttttactatgggaccggctgcgttttatttcggcgcagcggtaatt
ttgactattcttgctgtggaatggctggacagccgcttactttgggatgcacatgagtca
ggaaacgcccgcttcgacgactga
              
                            

Download fasta file
RegulonDB