RegulonDB RegulonDB 10.8: Gene Sequence
yebT gene sequence


Size: 2634        A: 626  T: 595  G: 752  C: 661

Fasta

 

>yebT E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaggaaacgcccgcttcgacgactgaagcgcagattaaaaataaacgccgtatc
tcacctttctggctgctgccgttcatcgcgctaatgattgccagttggctgatttgggac
agttatcaggaccggggtaataccgtcaccatcgactttatgtcggcggatggtattgtt
ccaggccgtacgcctgttcgttatcagggcgttgaagtcggaacagtgcaggatatcagc
ctcagcgacgatcttcgtaagattgaagtcaaggtcagcatcaagtccgatatgaaagat
gcgctgcgcgaagagactcagttctggctggtgacgccaaaagcatcgttggcaggtgtc
tccgggctggacgccctcgtcggtgggaactatatcggcatgatgccgggtaaaggtaaa
gagcaggatcactttgtcgcactcgatacccaaccgaaatatcggctggacaatggcgat
ctgatgatccacctgcaagcccccgatctcggttcgctgaacagcggttcattggtctat
ttccgcaagatcccggtgggaaaagtctacgactatgccatcaatcccaacaagcaaggc
gtggtgattgatgtcctgatcgagcggcgttttaccgatctggtgaaaaaaggtagccgt
ttctggaacgtttccggcgttgatgccaacgtcagtatcagtggcgcgaaggtgaaactg
gaaagcctggcggcactggttaacggtgcgattgccttcgattcaccagaagagtcgaaa
cctgccgaggcggaagatacctttggtctgtatgaagatctggcccacagccagcgtggc
gtaataataaaactggaactgccgagtggggccggattaaccgccgactcgacgccgtta
atgtatcaggggctggaagtcggacagctgactaaactggatttaaatcctggtggtaaa
gtcacaggggaaatgaccgttgatcccagcgtcgttaccctgcttcgtgaaaatacccgc
atcgaattacgcaacccgaaattatcccttagcgatgctaatctcagcgccctgctgacc
ggcaaaaccttcgagctggtgcccggcgatggcgagccacgcaaagagttcgttgttgtg
ccaggcgaaaaagcactgctgcatgaacctgatgttctgacgctgaccctgaccgcgccg
gaaagttacggtattgatgcgggtcagccgctcattcttcacggcgtgcaggtaggccag
gttatcgatcgtaaactcaccagcaaaggcgtcacctttaccgtcgccatcgagcctcag
catcgcgaactggtaaaaggcgatagcaaatttgtcgtcaacagccgtgtcgatgtgaag
gtggggctggatggcgttgagtttctcggtgccagcgcctcagaatggatcaatggcggg
atacgtattctgccgggcgataaaggtgagatgaaagccagctatccactgtatgccaat
ttggaaaaagcgctggagaacagccttagcgatttacccaccacaaccgtgagtttgagt
gcagagacgctgccggatgtgcaggcaggatcggtagtgctgtaccgtaaatttgaagtt
ggtgaagtgattaccgtgcgtccgcgagctaacgcgtttgatatcgatctgcatattaag
ccggagtatcgcaaccttctgaccagcaatagcgtgttctgggcagaaggcggggcgaaa
gttcagctgaatggtagtggtctgaccgtacaggcatccccgctctccagagcattaaag
ggagccattagcttcgacaacctcagcggtgccagcgccagtcagcgtaaaggcgataag
cgtattctgtatgcttccgaaacagcggcccgtgcggttggcgggcagattacgcttcac
gctttcgatgccggaaaactggcggtcgggatgccaattcgctatctcggtattgatatc
gggcaaatccagacgctggatctgattaccgcacgcaatgaagtacaggcaaaggcggta
ctttacccggaatatgtccagacctttgctcgcggtggtacgcgcttctcagtggtcaca
ccgcaaatttcggcagctggcgttgagcatcttgatactatcctccagccgtatatcaac
gtcgaaccaggccggggcaatcctcgccgcgactttgaattacaagaggccaccattact
gattcgcgttacctggatggcttaagcattattgttgaagcgccggaagccggttcgtta
ggcatcggtacgcctgtgctgttccgtggtctggaagtcggtacggttacaggaatgacg
ctggggacattgtcagatcgcgtgatgattgcgatgcgcatcagtaaacgctatcaacac
ctggtgcgtaacaattccgtcttctggttggcatcgggttacagtctggactttggtctg
acgggcggcgtagtgaaaaccggcacctttaaccagtttatccgtggcggcatcgccttc
gccacgcctccgggtacgccactggcaccgaaagcccaggaaggcaaacacttcctgttg
caggaaagtgaaccgaaagagtggcgtgaatggggaactgcgcttcccaaataa
              
                            

Download fasta file
RegulonDB