RegulonDB RegulonDB 10.10: Gene Sequence
rsmF gene sequence


Size: 1440        A: 332  T: 362  G: 381  C: 365

Fasta

 

>rsmF E. coli K12. Version NC_000913.3 GI:556503834
gtggcccaacacaccgtttatttcccggacgcctttctgacacaaatgcgcgaagcgatg
ccttcgacgctctcatttgatgattttcttgccgcctgtcagcgcccgttgcgccgcagc
attcgcgttaatacgctgaaaatctccgttgctgatttcctgcaattaaccgctccttat
ggctggacgcttacgccaattccgtggtgtgaagaaggtttctggattgaacgcgacaat
gaagatgcattgccattgggtagtaccgccgagcatttaagtggcctgttttatattcag
gaagccagttcaatgttgcctgttgccgccttgtttgctgacggtaatgcaccacagcgg
gtgatggatgtcgctgccgcgcctggctccaaaacgacgcaaatttccgcgcggatgaat
aacgaaggggcaatccttgccaatgagttttccgccagtcgggtaaaagtgttacatgcc
aatatcagccgctgtggtatcagtaatgttgcgctcacacattttgatggccgcgtgttt
ggtgcggcagtgccagaaatgttcgatgccattttgctggacgctccctgctctggcgaa
ggcgtggtgcgtaaagatcccgatgcgctaaaaaactggtcaccagaaagcaatcaggaa
atcgcagctacacaacgggagcttatcgacagcgcctttcatgcattacgtcctggtggt
acgctggtttactcgacctgtaccttaaaccaggaagaaaacgaagccgtttgcctgtgg
ctgaaagagacttaccccgacgcagtagagtttttaccacttggcgatctcttccctggt
gcaaacaaagcgctgaccgaagaaggctttttgcatgttttcccacaaatttacgactgc
gaaggcttcttcgttgctcgtctgcgtaaaactcaggcgattcccgccttacccgccccc
aaatacaaagtcggtaattttccgttcagcccggtgaaagatcgcgaagctggacaaatt
cgtcaggcggctacaggtgttggcttaaactgggatgaaaacctgcgcctctggcagcgt
gacaaagaactgtggttgttcccggtgggcattgaagccctgatcggtaaagtccgattt
tctcggttggggattaaacttgccgagacgcacaacaaaggttatcgctggcagcatgaa
gcggttattgctcttgcctcacccgataatatgaatgcattcgagctgacaccgcaggaa
gcggaggagtggtatcgcgggcgcgatgtttacccgcaagccgcgccagtggcggatgat
gtattggttactttccagcatcaaccgattggtttagccaaacggattggttcgcgattg
aaaaacagctatccgcgtgaactggtgcgcgatgggaaactttttaccggtaacgcctga
              
                            

Download fasta file
RegulonDB