RegulonDB RegulonDB 10.9: Gene Sequence
yebW gene sequence


Size: 192        A: 39  T: 65  G: 55  C: 33

Fasta

 

>yebW E. coli K12. Version NC_000913.3 GI:556503834
atgttcgcgctggtactttttgtttgctacctggatggcggttgtgaagatattgttgtg
gatgtctacaacacggaacagcagtgtctttattctatgagcgatcaacggatccgccag
ggcggttgttttccgattgaggattttatagatggtttctggcgacctgcacaggagtac
ggtgatttttaa
              
                            

Download fasta file
RegulonDB