RegulonDB RegulonDB 10.9: Gene Sequence
pphA gene sequence


Size: 657        A: 160  T: 183  G: 183  C: 131

Fasta

 

>pphA E. coli K12. Version NC_000913.3 GI:556503834
atgaaacagcctgcgcccgtttatcagagaattgcgggtcatcaatggcgacatatctgg
ctttctggcgatatacacggttgtcttgagcagttgcgccgcaaattatggcattgtcgt
tttgatccgtggcgagatttacttatctcagtgggagacgttatcgatcgtgggccgcaa
agtttacgttgtctgcagttactggaacaacattgggtttgtgcggtaagaggcaatcat
gaacagatggcgatggatgcgctggcatcccagcagatgtctttgtggttgatgaatggc
ggcgactggtttattgcgctggcagataatcaacagaaacaagcgaaaacggcgctggaa
aaatgtcagcatttgccctttattcttgaagtacacagtcgcaccggcaagcatgttatt
gctcatgccgattatccagatgatgtttatgaatggcaaaaggacgttgatttgcatcag
gtcttgtggagccgctcgcgattaggtgaacgccaaaaagggcagggaattacaggtgct
gatcatttctggtttggtcatacaccgttgcgacatcgcgtggatattggcaacctgcat
tatattgataccggtgctgtctttgggggcgaactgactcttgtgcaattgcaataa
              
                            

Download fasta file
RegulonDB