RegulonDB RegulonDB 10.9: Gene Sequence
znuA gene sequence


Size: 933        A: 258  T: 217  G: 240  C: 218

Fasta

 

>znuA E. coli K12. Version NC_000913.3 GI:556503834
atgttacataaaaaaacgcttcttttcgcagcattatccgccgctctctggggaggtgca
acacaggccgcagatgccgccgttgtcgcttcgcttaaacccgttgggttcatcgcttct
gccattgctgatggggtaacagaaacagaggttttacttcctgacggcgcttcagaacat
gattattcactgcgcccatcggatgtaaaacgcttacagaacgcggacttagtcgtttgg
gttggcccggagatggaagcgtttatgcaaaaaccggtaagcaaattaccaggagcgaag
caggtaacgattgcgcagcttgaagatgtgaaaccgctactgatgaaaagtattcacggc
gatgatgatgatcacgaccacgcggaaaaaagtgacgaagatcaccatcacggcgatttc
aacatgcatctttggctttccccagagatagcgcgggctacagcggttgcaatccatgga
aaattagtggaacttatgccgcaaagtcgagccaaacttgacgccaacctgaaggatttt
gaggcacaattagcctcaaccgaaacgcaggttggtaacgagctcgcgccgctcaagggg
aaaggttatttcgtttttcacgatgcttacggctatttcgaaaaacagtttggactgaca
ccgcttggtcattttaccgttaaccctgagattcaacctggcgcgcagcgtttacatgaa
ataagaacacagttggttgagcaaaaagcaacctgcgtttttgctgagccacagttcagg
ccagcggtcgttgagagcgtcgcacgagggacatccgttcgtatgggaacgttggatccc
ctggggacgaatatcaaactgggtaaaacaagctattcagaattcctgagtcaattagcc
aaccagtatgcgagctgcctgaaaggagattaa
              
                            

Download fasta file
RegulonDB