RegulonDB RegulonDB 10.9: Gene Sequence
znuC gene sequence


Size: 756        A: 180  T: 204  G: 193  C: 179

Fasta

 

>znuC E. coli K12. Version NC_000913.3 GI:556503834
atgacaagtctggtttccctggaaaatgtctcggtttcttttggccaacgccgcgtcctc
tctgatgtgtcgctggaacttaaacctggaaaaattttgactttacttgggccaaatggc
gcaggtaagtcgacactggtacgggtagtgctcgggctggtaacacccgatgaaggggtt
atcaagcgcaacggaaaactgcgcatcggctatgtaccgcagaagctgtatctcgacacc
acgttgccactgaccgtaaaccgttttttacgcttacgccctggtacacataaagaagat
attttgcctgcactgaaacgtgtccaggccgggcacctgattaacgcaccgatgcaaaag
ctctctggtggcgaaacgcagcgtgtactattagcgcgagcattgttaaatcgcccgcaa
ttattagtgctggatgaacccactcaaggcgtggatgtaaatggccaggtggcgttatat
gaccttattgaccaactgcgtcgtgaactggattgtggcgttttaatggtttctcacgat
ctgcatctggtgatggcaaaaaccgatgaagtgctgtgcctgaatcaccacatttgttgt
tccggcacaccggaagttgtttccctgcatccggagtttatttcaatgtttggtcctcgt
ggtgctgaacaactgggtatctatcgccatcatcataaccatcgtcacgatttacaggga
cgaattgttttgcgtcggggaaatgatcgctcatga
              
                            

Download fasta file
RegulonDB