RegulonDB RegulonDB 10.9: Gene Sequence
yecN gene sequence


Size: 396        A: 67  T: 128  G: 115  C: 86

Fasta

 

>yecN E. coli K12. Version NC_000913.3 GI:556503834
atggtaagcgcgctgtacgccgttttaagtgcgttgttattaatgaagttctcttttgat
gtcgttcgcctgcgaatgcagtaccgcgttgcctatggcgacggcggttttagcgaactg
caaagcgctattcgcattcatggtaacgcggtggaatatattcccatcgcgattgtgctg
atgctgtttatggaaatgaatggcgcagaaacctggatggtgcatatttgcggcatcgtt
ttgcttgctggtcgtctgatgcattattacggttttcatcaccgtctgttccgctggcga
cgttccggcatgagcgccacctggtgtgcgctgttgctgatggtgctggcgaatctttgg
tatatgccctgggagttggttttctccctgcgttag
              
                            

Download fasta file
RegulonDB