RegulonDB RegulonDB 10.9: Gene Sequence
cmoB gene sequence


Size: 972        A: 227  T: 239  G: 271  C: 235

Fasta

 

>cmoB E. coli K12. Version NC_000913.3 GI:556503834
atgatcgactttggtaacttttattctctgattgccaaaaatcatctttcacactggctc
gaaacgctgcccgcgcagattgctaactggcagcgcgagcagcagcacgggttgtttaag
cagtggtcaaatgcggtggagtttctacctgaaattaaaccgtatcgtcttgatttattg
catagcgttacggcagaaagcgaagagccactgagcgcagggcaaattaaacgcattgaa
acgctgatgcgcaacctgatgccgtggcgcaaagggccgttctcactgtatggcgtcaac
atcgataccgaatggcgttccgactggaaatgggatcgtgttctgccccatctttctgat
ttaaccggacgcaccattctggatgtcggctgcggcagcggttatcacatgtggcgcatg
attggcgcaggcgcgcacctcgcggtggggatcgaccctacgcaactgtttctgtgccag
tttgaagcggtgcgtaaactactgggtaatgatcagcgcgcgcatttgttaccgttaggt
attgaacaacttccggcactgaaagcctttgataccgtcttttcgatgggcgtgctttac
catcgccgttcaccgctggagcatctatggcagttgaaagatcaactggtcaatgaaggt
gaactggtgctggaaacgctggttattgatggtgatgagaacacggtgctggtaccaggc
gatcgttacgcgcaaatgcgtaatgtctatttcatcccttccgcgctggcgctgaaaaac
tggctgaagaagtgtggttttgtagatatccgcattgcggatgtgagcgttaccaccaca
gaagagcagcgacgcaccgaatggatggttaccgaatcgctggccgatttcctcgaccca
catgatccgggtaaaacggtggaaggttatccggcacctaaacgcgcggtgctgattgcg
cgcaagccgtaa
              
                            

Download fasta file
RegulonDB