RegulonDB RegulonDB 10.9: Gene Sequence
torZ gene sequence


Size: 2430        A: 655  T: 528  G: 683  C: 564

Fasta

 

>torZ E. coli K12. Version NC_000913.3 GI:556503834
atgacattaacaagacgtgaatttattaaacacagcggtattgccgctggagcgctggtg
gtgacatcggcagcaccgctccccgcatgggcagaagagaagggcggtaaaatcctcacc
gcgggacgttggggagcgatgaacgtagaagtgaaggacggcaagattgtttcttcaaca
ggcgcgctggcgaaaaccataccgaattccttacagtctacggcggcggatcaggtacac
accacggcgcgtattcagcatccgatggtgagaaaaagctatctcgataatccactgcaa
ccggcgaaaggtcgtggcgaagatacctatgtacaggtgagctgggaacaggcattaaaa
ctgattcatgagcaacatgatcgtattcgtaaagctaacggaccatcggccatttttgcc
ggatcttacggctggcgctcttctggcgtgttgcataaagcgcaaaccttactgcaacgt
tatatgaacctggcgggcggttattccgggcatagcggcgattattcaaccggggcagca
caggtgatcatgccgcatgtggtcggttctgtagaggtgtatgaacagcagacctcctgg
ccgctgattctggaaaacagccaggttgtggtgctgtggggaatgaacccgctgaatacc
ttaaaaattgcctggagcagtaccgatgagcaagggctggaatacttccatcagctgaaa
aaatctggcaaaccagtgattgccattgatcctatccgctccgaaaccatcgaattcttt
gacgataatgccacctggatcgcgccgaatatgggcaccgacgtggcactgatgttaggg
attgcgcataccctgatgacacaaggcaaacacgataaagtgttccttgaaaaatacact
accgggtatccgcagtttgaagagtatctgacaggtaagagcgataatacgccgaagagc
gcggtctgggcggcggaaattactggcgtaccggaagcgcagatagtcaaactcgctgaa
ctgatggcggcgaatcgcacaatgctgatggcaggctggggaattcagcgccagcaatat
ggtgaacagaaacactggatgctggtgacgctggcggcgatgttagggcagattggtaca
ccgggcggcggttttggtttctcttatcattactccaacggtggcaacccgacgcgtgtt
ggcggcgtgctgccggaaatgtctgcggcgattgccggacatgccagcgaggccgctgat
gatggcggaatgacggcgattcctgttgcccgtatcgtcgatgcgctggaaaatcctggc
ggcaaatatcagcataacggtaaagaacaaacgtatccgaatatcaaaatgatctggtgg
gcgggtggcggtaactttacccatcaccaggatactaatcgtctgattaaagcatggcag
aaaccggagatgatcgtcgtttctgaatgctactggaccgcagcagccaaacacgcagat
atcgtattaccgatcaccacatcgtttgagcgcaatgacttgacgatgaccggtgattac
agcaaccagcatattgtgccgatgaagcaggctgttgctccgcaatttgaagcgcgtaac
gattttgacgtgtttgccgatcttgcggaattactcaaacctggcggaaaagagatctat
accgaaggtaaagatgaaatggcgtggctgaaatttttctatgatgccgctcagaaaggt
gcccgtgcgcaacgcgtcactatgccaatgtttaatgccttctggcagcaaaataaactg
atcgaaatgcgccacagcgagaagaacgaacagtacgttcgttatggtgatttccgcgcc
gatccggtgaaaaatgcgctgggtacgccaagcggcaaaattgaaatctattcaaaaacg
ttggaaaaatttggctataaggattgcccggcacacccaacctggctggctcctgatgaa
tggaaaggtaccgccgacgagaagcagttacagcttctgaccgcacatccggcacaccgt
ttacacagtcagcttaactatgcggaactgcgtaaaaaatatgcgatcgccgatcgtgaa
ccaatcactattcacaccgaagatgctgcacgctttggtattgcgaatggcgatctggtg
cgtgtctggaacaaacgtggtcagattttgacaggcgcggtggtgactgacgggatcaaa
aaaggcgtggtatgcgtgcatgaaggtgcatggccagatctggaaaatggcttgtgtaaa
aacggcagtgcgaacgtgttaacggcggatatccccagctcgcagctggcaaatgcctgt
gccggtaactcagcgttggtgtatatcgaaaaatatacgggcaatgcaccgaagttaacg
gcgtttgatcagccagctgttcaggcgtaa
              
                            

Download fasta file
RegulonDB