RegulonDB RegulonDB 10.8: Gene Sequence
torY gene sequence


Size: 1101        A: 320  T: 259  G: 276  C: 246

Fasta

 

>torY E. coli K12. Version NC_000913.3 GI:556503834
atgcgagggaaaaaacgcattgggttattgtttttgctgatagcggttgtggttggtggc
ggcgggttattgctggcgcaaaaagtcttacataaaacgtcggatacagcattttgcctt
tcctgccactcgatgagtaaaccttttgaggaatatcagggaactgtccacttttcgaac
cagaaagggatacgtgcggaatgtgccgattgccatattccaaagtcagggatggattat
ttatttgctaaattaaaggcatctaaagatatttatcatgaatttgttagcggcaaaata
gacagtgacgataagttcgaagctcatcgccaggaaatggccgaaacagtatggaaagaa
ttaaaagccactgactctgcaacgtgccgtagttgccattcttttgatgccatggatatt
gcctcgcaaagtgaatctgcgcagaaaatgcataacaaagcacaaaaggacagcgaaacc
tgtatcgattgtcataaaggcattgcccattttccgccagaaataaaaatggatgacaac
gcggcgcatgagctggaaagtcaggccgctacttcagttactaatggcgcacatatttat
cctttcaaaacttctcacataggcgagctggctaccgtgaatcctggaaccgatctcacc
gtcgttgatgccagtggcaaacagccgatcgttctgttgcagggttatcaaatgcagggc
agtgaaaacacgctctacctggcggcaggtcaacggctggcgctagccacattaagtgaa
gaaggtatcaaggcgctcactgtaaacggggaatggcaggctgacgaatacggcaatcaa
tggcgtcaggcgtctttacagggtgcgcttaccgatcccgcattagcggaccgtaaaccg
ctatggcaatacgctgaaaaacttgacgatacctattgcgctggttgtcatgcccctatt
gccgccgaccattacaccgtcaatgcgtggccgtccattgccaaaggaatgggggcacga
accagcatgagcgaaaacgaactggacattttaacgcggtatttccagtacaacgccaaa
gatattaccgagaaacagtga
              
                            

Download fasta file
RegulonDB