RegulonDB RegulonDB 10.9: Gene Sequence
cutC gene sequence


Size: 747        A: 183  T: 176  G: 211  C: 177

Fasta

 

>cutC E. coli K12. Version NC_000913.3 GI:556503834
atggcattactggaaatttgctgttacagcatggaatgtgcactaacggcgcagcaaaac
ggcgcagacagagttgaattatgcgcagccccaaaagaggggggcttaacgccgtcgttg
ggtgtactgaaatccgtgcgccagcgggtgacgatccctgtgcatccgataattcgccca
cgcggtggtgatttttgctacagcgacggtgagtttgccgccattcttgaggatgtgcgc
acggtccgcgaattaggttttcctggactggtgacgggcgttctcgatgttgacgggaat
gtcgatatgccacgaatggaaaaaataatggctgctgccggtccgctggcagtgactttt
catcgcgccttcgatatgtgcgctaaccctttatatacactcaataatcttgcggaattg
ggcattgcccgggtactgacatcagggcaaaaatcagacgcactgcaaggtttatcaaaa
attatggaacttattgcccatcgtgatgctccaatcattatggccggagcaggagtccgt
gcagaaaacctgcaccacttcctcgatgccggagtgctggaagtccatagctccgcggga
gcgtggcaagcctcaccgatgcgttatcgtaatcaaggattgtccatgtcatcagatgaa
cacgcggacgagtattcgcgttatatcgtagacggggcggcggttgctgaaatgaaagga
atcattgaacgccatcaggccaaatga
              
                            

Download fasta file
RegulonDB