RegulonDB RegulonDB 10.9: Gene Sequence
yecM gene sequence


Size: 567        A: 139  T: 140  G: 152  C: 136

Fasta

 

>yecM E. coli K12. Version NC_000913.3 GI:556503834
atggcgaactggcaatctatcgacgagctgcaggatattgcatcggatttaccgcgattt
atccacgcattagatgaactttcccgccgtctggggttgaatatcactccgctgactgcc
gatcacatttctttgcgttgccatcaaaacgccactgctgaacgctggcgtcgcgggttt
gaacagtgtggcgagcttttgtcagaaaatatgatcaatggcagaccgatttgtctgttt
aaattgcatgaaccggtacaggttgcgcactggcagttttctattgtggagctaccgtgg
cccggggaaaaacgttacccacacgaaggttgggaacatattgaaatcgttctgccgggt
gatccagaaacgctgaatgcccgtgcgctggcattgctttctgatgaaggactcagccta
ccggggatctcagtgaaaaccagttcgccaaaaggtgagcatgagcgattaccgaatccg
acgctggcggtcaccgatggcaaaacaactattaagtttcatccgtggtccattgaagag
atcgttgccagcgagcagtcggcgtaa
              
                            

Download fasta file
RegulonDB