RegulonDB RegulonDB 10.9: Gene Sequence
uspC gene sequence


Size: 429        A: 116  T: 120  G: 104  C: 89

Fasta

 

>uspC E. coli K12. Version NC_000913.3 GI:556503834
atgagctatagcaatattcttgtcgctgttgcggttacaccggaaagtcagcaactgctg
gcaaaagcggtatctatcgccaggccagtaaagggacacatcagtttaattactctcgct
tccgacccggaaatgtacaatcaattagctgcgccgatgcttgaagatttacgcagcgtg
atgcatgaagaaacgcaaagctttcttgataagttaattcaggatgcggggtatcccgtt
gacaagacgtttattgcctacggtgagttaagcgaacatattctggaagtatgtcacaag
catcatttcgatttggtgatttgcggtaatcacaatcacagtttcttttcgcgagcatcc
tgctcggcgaaaagagttattgcctcaagtgaggtcgatgtgctgttagttccacttacg
ggagattaa
              
                            

Download fasta file
RegulonDB