RegulonDB RegulonDB 10.9: Gene Sequence
null gene sequence


Size: 339        A: 84  T: 94  G: 87  C: 74

Fasta

 

>null E. coli K12. Version NC_000913.3 GI:556503834
atgcattgcgccgatgaaggttttgagaaaccgctgcctcatctgtttgaagcagcggtt
tttttaatgggattcaccctgtggggtaaacttgagttcaataagcgcgatggctttttg
gattgcccgcatggtgaccgggtctgcggcggcgggatggttagtaaagtcgatattctt
cagctgactggacattttttcacgaacttcaacgggcgcgattacatcgagaacatccag
aatttgtttgataaccaactggcaagcaaccacatcagaaaccaattcctgatcggcatt
cagcggctgggacatcgtaaactcctgatagcattttga
              
                            

Download fasta file
RegulonDB