RegulonDB RegulonDB 10.9: Gene Sequence
yecR gene sequence


Size: 324        A: 65  T: 96  G: 79  C: 84

Fasta

 

>yecR E. coli K12. Version NC_000913.3 GI:556503834
atgagacttctgattctgactctttcattaataacgctggcggggtgtacggttactcgc
caagcccatgtgagcgaagttgacgcggcaacaggtattgtacggttagtttatgaccag
gcttttttgcagcatgcccataccgatcgttatgtcagtcgcgggatcgccgatcgcgca
tgccagcaggaaggctatacccacgcggtcccctttggtcagccagtaggcaactgtagc
ctttttgcgggttccttatgtttgaatacggaattcactttgtcatatcagtgccatcat
tccgccttccctgtctttctctaa
              
                            

Download fasta file
RegulonDB