RegulonDB RegulonDB 10.9: Gene Sequence
yecH gene sequence


Size: 240        A: 67  T: 60  G: 66  C: 47

Fasta

 

>yecH E. coli K12. Version NC_000913.3 GI:556503834
atggactctattcacggtcatgaagtgttaaatatgatgattgaatcaggcgagcaatat
acgcatgccagtctggaagctgcgattaaagcgcgttttggtgaacaggcacgttttcac
acctgctcggcagaagggatgacagcgggagagctggtagcgtttctggcagcaaaaggc
aaatttataccttcgaaagacggtttttcgaccgatcagagtaagatttgccgtcactga
              
                            

Download fasta file
RegulonDB