RegulonDB RegulonDB 10.9: Gene Sequence
tcyL gene sequence


Size: 669        A: 131  T: 185  G: 183  C: 170

Fasta

 

>tcyL E. coli K12. Version NC_000913.3 GI:556503834
atgcaagaaagtatacaactggttattgattccttgccgttcctgctgaaaggggctggg
tatacgctgcaactcagtatcggcggcatgttttttggcttactgctcgggtttattctc
gcgctgatgcgtctgtcgccaatctggcccgtgcgctggctggcgcgtttttatatctct
atttttcgtggtacgccgctcatcgcacaactgtttatgatctattacggcctgccgcag
tttggtatcgaattagatcccattccgtcagcaatgattggtctgtcgttgaacactgcc
gcctatgctgccgaaacgctgcgcgccgccatttcttctattgataaaggtcagtgggaa
gcggcagccagtattggtatgacgccgtggcagaccatgcgtcgcgcgattttgccacag
gcggcgcgtgtggcgttgccgccgctgtcgaacagctttattagcctggtaaaagatacg
tcgctggccgcgacaatccaggtgccggagctgttccgtcaggcgcagttgattacctcg
cgtacgctggaggtgttcaccatgtatctggcggcttcgctcatctactggatcatggcg
actgtgttatcgacgttgcagaaccattttgagaatcaacttaatcgccaggagagagaa
ccaaaatga
              
                            

Download fasta file
RegulonDB