RegulonDB RegulonDB 10.10: Gene Sequence
dcyD gene sequence


Size: 987        A: 223  T: 231  G: 284  C: 249

Fasta

 

>dcyD E. coli K12. Version NC_000913.3 GI:556503834
atgccactgcataatttaacccgttttccacggctggagtttatcggcgcgccaacgccg
ctcgaatatctgccgcgcttttctgattatctaggacgggaaattttcatcaaacgggat
gacgtcacccccatggcaatgggcggcaataaattacgtaagctggaatttctcgcggca
gatgctctgcgtgaaggtgccgatacgctgattactgccggggcgatccagtctaaccat
gtgcggcagactgccgcagtcgctgccaaactcggtctgcactgcgtggcgctgctggaa
aatcctattggcacaaccgcagaaaactatttaaccaacggcaatcgcttgttgctggat
ctgttcaatacccagattgaaatgtgcgacgcactgaccgatcccaatgcccaactggaa
gagctggcgacgcgagtcgaagcacaaggctttcgcccgtatgtcattccggttggcggt
tctaatgctcttggcgcgctaggttatgtggagagtgcgctggaaatcgcgcaacagtgt
gaaggggcggttaatatttcatcggtggtagtcgcatcgggcagtgccggaactcacgcc
ggactggctgttgggctggaacacctgatgcctgaaagcgaactgattggcgtgaccgtg
tcgcgttccgttgccgatcaattgccgaaagtggttaacctacaacaggcgattgcgaaa
gaactggagctgaccgcatcagcggaaattttactctgggatgactattttgcacctggc
tacggcgtgccgaacgacgaaggcatggaagcagtgaaattgctggcgcggctggaaggc
attctgcttgatcctgtgtataccggaaaagcgatggcggggctgattgacggtatcagt
cagaaacgcttcaaagatgaagggccgattctgtttattcataccggcggtgcgcctgcg
ctgttcgcctatcatccccacgtttag
              
                            

Download fasta file
RegulonDB