RegulonDB RegulonDB 10.9: Gene Sequence
yedL gene sequence


Size: 480        A: 127  T: 127  G: 112  C: 114

Fasta

 

>yedL E. coli K12. Version NC_000913.3 GI:556503834
atgttcacgattaaaacagatgatctcacccatccagcagtgcaagcattagtggcttac
catatttccggcatgctgcagcagtctccccccgaaagcagtcatgctttagatgtgcaa
aaattacgtaacccgacagtgacattctggtcagtatgggaaggcgaacaactcgcagga
attggtgcgctgaagttgctggatgataaacacggcgagctgaaatcaatgcgtaccgcg
ccaaattatttacgtcgtggtgtcgccagtctgattttacgccacattttgcaggtcgcc
caggacagatgccttcatcgcctgagcttagaaacgggtacacaggctggatttacggcc
tgccatcaactttatttgaagcatggtttcgctgattgcgaaccgtttgctgattatcga
cttgatccacacagtcgatttttatcattgacgctatgcgaaaataatgaattgccatga
              
                            

Download fasta file
RegulonDB