RegulonDB RegulonDB 10.8: Gene Sequence
yedN gene sequence


Size: 1129        A: 388  T: 360  G: 205  C: 176

Fasta

 

>yedN E. coli K12. Version NC_000913.3 GI:556503834
atgtttccattaaatgatctttcgttaaaaactcagccggttcaattaaataaagtcaca
tctaatactgaatctacgataaaacaacatgagttagtatctgatgatgcaatcataaat
gaattatcaagtgagttagtcagttgtcttggaaatggtaagtttacaccaattagtgaa
gacagcaaattatttaatatgctgtcagaatttaagttattgcactcagaatatttcgaa
tggggtgattatagtctctggtttcaagatttctcgatttataataagataggttttatc
atgatagaaaaaatcagggaactggtaacccacccattcggcataaattagagtttatat
cgactaatattgcagagtttctagacaactttacgaaaattacagattccagactttgca
aaggtttcagcgactgggctaattcagtaaaagaaggcgcatcgaatgacttcaaaaaaa
atgtggatatagcattggtgagattgtttaaatgtgttgaactccacaatagtaaacttg
acttaacagatcttcacttggggtctttgccacctcttccatcctggattgaggtgcttt
atcttcgtcataatggccttgccacaatacaaattcccaaattctgcaaagaattagagc
tcgatttcaataattatatggtatttccaaaagtatccgatggaattacccaggtctccg
tagataataatctgatatcgcgtgttgactcatctccgtcaaaggctatgacaatttcta
tttatcgcaataaaatatggtaaataccagcaatgcctgagactactaagctgtttaatt
gtggcgataataagataaaagaaattcaatacttcccaaatcatctggagaaagcacgta
tggagtgtgatattgaggttgtctctgcgatatatagcaataaagaattactttttaaag
aatgtaattcttttgaagagacatttttatatcatggactttgacagggatttgctatga
aagatcgcagcgaaaatatattgttacgaatcccgctgattatgataaatattccgatat
ggttaaaaagtatgtaatagatggtgaggaactcataattaaatattaa
              
                            

Download fasta file
RegulonDB