RegulonDB RegulonDB 10.9: Gene Sequence
intG gene sequence


Size: 279        A: 77  T: 68  G: 65  C: 69

Fasta

 

>intG E. coli K12. Version NC_000913.3 GI:556503834
gtggtcgtaacaacatccgacgtggtgatgtgtcaaatgagacgctctgatgttcagggg
ggttatcgcgtatacggatcgtggatggcagaaaacgttcaggatcaggtatccatttta
aaccagaaattgagtgagtttgccccatccatgccccacgcggtgagatcggatgtaatt
aacaacaggttacaaaacctacacctgcatgctcatcacttcctgatacgccgccaccag
cttattacgcacctgaatccccatttgcatagaaactga
              
                            

Download fasta file
RegulonDB