RegulonDB RegulonDB 10.9: Gene Sequence
dsrA gene sequence


Size: 91        A: 20  T: 33  G: 17  C: 21

Fasta

 

>dsrA E. coli K12. Version NC_000913.3 GI:556503834
aacacatcagatttcctggtgtaacgaattttttaagtgcttcttgcttaagcaagtttc
atcccgaccccctcagggtcgggattt
              
                            

Download fasta file
RegulonDB