RegulonDB RegulonDB 11.0: Gene Sequence
yedP gene sequence


Size: 816        A: 203  T: 188  G: 225  C: 200

Fasta

 

>yedP E. coli K12. Version NC_000913.3 GI:556503834
atgttttcaattcaacaaccactactggtttttagcgatcttgatggcaccctgctggac
agtcatagttatgactggcaaccggcagccccctggctcacccgtttacgcgaagcaaat
gttcccgtcattctctgtagcagtaaaacatcagcggaaatgctgtacttgcaaaaaacg
ttggggctacaaggtttaccgctgattgccgaaaatggcgcagtgatccagcttgctgag
caatggcaggagatagacggttttccacgcatcatctcaggtattagccatggcgaaatc
agcctggttttaaatacgctacgcgagaaagaacattttaaattcacgacttttgatgat
gtcgacgatgcaaccatcgccgaatggacgggattaagccgtagccaggcggcgctgacg
cagcttcatgaggcgtcggtaacgctaatctggcgcgacagtgacgagcgtatggcacaa
tttaccgctcgtctgaacgaactgggcttacagtttatgcagggtgcgcgcttctggcac
gtactggatgcttctgccggaaaagatcaggctgccaactggattatcgcgacctatcaa
caattgtcaggcaaacgcccaaccacacttggcctgggcgatgggccaaacgatgcgccc
ttactggaggtaatggattacgcggtgattgtgaaagggctaaatcgtgaaggggtgcat
ctgcatgatgaggatccggcccgcgtctggcgaacgcagcgtgaaggaccggaaggatgg
cgtgaagggctggaccattttttctccgcccgttaa
              
                            

Download fasta file
RegulonDB