RegulonDB RegulonDB 10.9: Gene Sequence
dgcQ gene sequence


Size: 1695        A: 394  T: 430  G: 452  C: 419

Fasta

 

>dgcQ E. coli K12. Version NC_000913.3 GI:556503834
gtgcagcacgagacaaaaatggaaaaccagagctggttgaaaaaactcgcacgccgcctg
gggcctggtcatgtcgttaatctctgctttatcgtggtattgcttttttccaccttgctc
acctggcgtgaagtggtggtgctggaagatgcctatatctccagccagcgtaatcatctg
gaaaacgttgccaacgcgctcgataagcatttgcagtataacgtcgacaaactgatcttt
ttacgtaatggcatgcgcgaagctctcgtagcgccactggatttcacctctctgcgtgat
gctgtaaccgagttcgaacagcatcgcgacgagcacgcctggaaaatcgaactcaaccga
cgacgcactctgccagttaatggtgtgtcggatgcattagtcagcgaggggaatctcctg
tctcgcgaaaatgaaagcctcgacaatgaaattaccgctgcactggaagttggttacttg
ctgcgactagcgcacaactcctcgtcgatggttgaacaggcgatgtatgtctcgcgtgcc
ggattttacgtttcgacgcagccgaccttgtttacgcgcaatgttccaacgcgttattac
ggctatgtcacccaaccctggtttattggccattcacaacgagaaaatcgtcaccgcgcg
gtacgctggttcacttcgcaaccggaacacgccagcaatactgaaccgcaggttaccgtc
agtgttccggtagacagtaataactactggtatggcgtgctggggatgagtattcccgtg
cgtactatgcagcaatttttaagaaacgccatcgataaaaacctcgatggtgagtatcag
ctctatgacagtaagctgagatttttgacctcttccaatcctgaccatccaacagggaat
atttttgatcctcgtgaactggccttgctggcgcaggcaatggaacatgacacgcggggc
ggcattcgtatggacagtcgctatgttagctgggaacgtctggaccatttcgacggtgtg
ctggtgcgtgtccatacgttaagcgaaggcgtgcgcggcgatttcggcagtatcagcatt
gcattaaccctgctgtgggcgctctttaccaccatgttactcatctcctggtatgtgatt
cgccggatggttagcaacatgtatgttctgcaaagctcgttgcagtggcaggcgtggcac
gacaccttaacgcgtttatataaccgtggcgcactgttcgaaaaagcccgtccgctcgct
aaattgtgtcagacgcaccaacatcctttttctgtcattcaggtcgatcttgaccatttt
aaagcgattaatgaccgctttggtcatcaggcgggcgaccgtgttctttctcatgctgcc
ggattaattagcagttccttgcgtgcgcaggacgttgccgggcgggtcggtggtgaggag
ttttgtgtgattctgccaggcgcgagtctgacggaggctgcggaggtcgcagaacgtatt
cgactgaaattaaatgaaaaagagatgttgatcgccaagagtacgacgatacgcatcagt
gcctcgctgggggtaagcagcagcgaggaaaccggtgattatgattttgaacaactccag
tcactggccgaccgtcggctttatctcgctaaacaggctgggcgtaatcgggtattcgcg
agcgataacgcttaa
              
                            

Download fasta file
RegulonDB