RegulonDB RegulonDB 10.9: Gene Sequence
yodC gene sequence


Size: 183        A: 39  T: 47  G: 69  C: 28

Fasta

 

>yodC E. coli K12. Version NC_000913.3 GI:556503834
atgagctttatggttagtgaggaagttacggttaaagagggcggcccgcggatgattgtc
actggatactccagcggtatggttgagtgtcgttggtatgacggttacggggtcaagcgg
gaagcttttcatgaaaccgagcttgttccgggggaggggagtcgttctgcggaagaagtg
tga
              
                            

Download fasta file
RegulonDB