RegulonDB RegulonDB 10.9: Gene Sequence
drpB gene sequence


Size: 303        A: 61  T: 79  G: 94  C: 69

Fasta

 

>yedR E. coli K12. Version NC_000913.3 GI:556503834
gtggaaaaatgtgacttttatcacataatagtactaagtctgaattttccgggttatctc
aaaatggaatacggttcgacaaagatggaagagagactctctcgcagccctggcggcaaa
ctggctttgtgggctttctatacatggtgtggctatttcgtctgggcaatggcgcgttac
atctgggtgatgagccggattcccgatgcccccgtgtcgggatttgaaagcgatttaggc
tctaccgcgggaaagtggttaggggcactggtcggatttttatttatggctctggtcggg
gcattgttaggcagcattgcctggtacacccgacctcgtcccgcacgtagcagacgctat
gaataa
              
                            

Download fasta file
RegulonDB